Spanish-French leech trade and its consequences: From the increase in medical demand to resource depletion and technical innovation.

This article studies the impact caused by the success and dissemination of Broussais' theories on the use of leeches as a medical supply on Spanish-French trade relations, as well as its consequences for the Spanish market between 1821 and the 1860s. Analysing the documents produced by the different public administrations, together with newspaper and archival sources in both Spain and France and the literature and legislation of that period, allows us to understand the evolution of this trade and the heavy impact it had on the autochthonous population of this animal resource. The article reveals how, at the beginning of the 1820s, leeches became an important medical supply and how the demand for them increased significantly. This gave rise to a trade relation between Spain and France that led to the overexploitation of the resource, the issuing of regulations on the matter, and the search for technological solutions to increase the production of leeches.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Transcriptomic profiling and the first spatial expression analysis of candidate genes in the salivary gland of the East Asian medicinal leech, Hirudo nipponia.

Hirudo nipponia, a blood-sucking leech native to East Asia, possesses a rich repertoire of active ingredients in its saliva, showcasing significant medical potential due to its anticoagulant, anti-inflammatory, and antibacterial effects against human diseases. Despite previous studies on the transcriptomic and proteomic characteristics of leech saliva, which have identified medicinal compounds, our knowledge of tissue-specific transcriptomes and their spatial expression patterns remains incomplete. In this study, we conducted an extensive transcriptomic profiling of the salivary gland tissue in H. nipponia based on de novo assemblies of tissue-specific transcriptomes from the salivary gland, teeth, and general head region. Through gene ontology (GO) analysis and hierarchical clustering, we discovered a novel set of anti-coagulant factors-i.e., Hni-Antistasin, Hni-Ghilanten, Hni-Bdellin, Hni-Hirudin-as well as a previously unrecognized immune-related gene, Hni-GLIPR1 and uncharacterized salivary gland specific transcripts. By employing in situ hybridization, we provided the first visualization of gene expression sites within the salivary gland of H. nipponia. Our findings expand on our understanding of transcripts specifically expressed in the salivary gland of blood-sucking leeches, offering valuable resources for the exploration of previously unidentified substances with medicinal applications.

The effect of blood human, domestic and small laboratory animals on the viability and behavior of the medicinal leech.

Medicinal leeches are used for therapeutic purposes in the prevention and treatment of many diseases. Because they have a large amount of biologically active substances in their body. Each of these substances has many therapeutic effects. In natural conditions, they are mostly are fed of blood by wild animals. In laboratory conditions, the blood of domestic animals is mostly used.  Currently, medicinal leeches are mostly bred in laboratory conditions. Because there are very few of them in nature. They are listed in the Red Book. Scientists of various specialties are looking  for optimal conditions for their life and breeding. That became our research goal. To identify the influence of blood human, domestic animals (pigs and chickens) and small laboratory animals (rats) on the viability and behavior of medicinal leeches Hirudo verbana Carena, 1820 and Hirudo orientalis Utevsky & Trontelj, 2005. According to this, 8 groups of sexually mature animals were formed: 1 and 2 - human blood; 3, 4 - blood of a domestic pig; 5, 6 - blood of domestic chickens; 7, 8 - blood of a non-linear laboratory rat. As a result of the study, it was found that the blood of pigs and chickens is the most suitable for feeding the medical leech for normal life and behavior. Mortality of leeches was observed when feeding on rat and human blood. It should be noted that at the beginning of feeding animals with blood human. The percentage of cannibalism in animals increased.

Repetitive nociceptive stimulation elicits complex behavioral changes in Hirudo: evidence of arousal and motivational adaptations.

Appropriate responses to real or potential damaging stimuli to the body (nociception) are critical to an animal's short- and long-term survival. The initial goal of this study was to examine habituation of withdrawal reflexes (whole-body and local shortening) to repeated mechanical nociceptive stimuli (needle pokes) in the medicinal leech, Hirudo verbana, and assess whether injury altered habituation to these nociceptive stimuli. While repeated needle pokes did reduce shortening in H. verbana, a second set of behavior changes was observed. Specifically, animals began to evade subsequent stimuli by either hiding their posterior sucker underneath adjacent body segments or engaging in locomotion (crawling). Animals differed in terms of how quickly they adopted evasion behaviors during repeated stimulation, exhibiting a multi-modal distribution for early, intermediate and late evaders. Prior injury had a profound effect on this transition, decreasing the time frame in which animals began to carry out evasion and increasing the magnitude of these evasion behaviors (more locomotory evasion). The data indicate the presence in Hirudo of a complex and adaptive defensive arousal process to avoid noxious stimuli that is influenced by differences in internal states, prior experience with injury of the stimulated areas, and possibly learning-based processes.

Structural insights into thrombolytic activity of destabilase from medicinal leech.

Destabilase from the medical leech Hirudo medicinalis belongs to the family of i-type lysozymes. It has two different enzymatic activities: microbial cell walls destruction (muramidase activity), and dissolution of the stabilized fibrin (isopeptidase activity). Both activities are known to be inhibited by sodium chloride at near physiological concentrations, but the structural basis remains unknown. Here we present two crystal structures of destabilase, including a 1.1 Å-resolution structure in complex with sodium ion. Our structures reveal the location of sodium ion between Glu34/Asp46 residues, which were previously recognized as a glycosidase active site. While sodium coordination with these amino acids may explain inhibition of the muramidase activity, its influence on previously suggested Ser49/Lys58 isopeptidase activity dyad is unclear. We revise the Ser49/Lys58 hypothesis and compare sequences of i-type lysozymes with confirmed destabilase activity. We suggest that the general base for the isopeptidase activity is His112 rather than Lys58. pKa calculations of these amino acids, assessed through the 1 µs molecular dynamics simulation, confirm the hypothesis. Our findings highlight the ambiguity of destabilase catalytic residues identification and build foundations for further research of structure-activity relationship of isopeptidase activity as well as structure-based protein design for potential anticoagulant drug development.

Protective efficacy of Eglin C from Hirudo medicinalis against Eimeria papillata-induced coccidiosis.

The current study aimed to find a new therapeutic agent from Hirudo medicinalis for murine coccidiosis. Ion-exchange chromatography was performed to separate different fractions of HEA (hirudo extract antigens). Eight different fractions were experimentally tested against murine eimeriosis induced by Eimeria papillate. The oocysts output was counted to determine the most effective fractions. For the five most effective fraction groups, jejunal histological examination and goblet cells count as well as mRNA expression of MUC2 gene using RT-PCR were performed. The data indicated that these fractions significantly decreased the oocysts output and the number of parasite developmental stages, while the goblet cell numbers and the expression of MUC2 were increased. Effective fractions were subjected to SDS-PAGE and proteomic analysis for detection of their bioactive macromolecules. The fractions reveled only a protein at 8 kDa while the results of spectroscopy and bioinformatics identified the protein as Eglin C. The pooled fractions containing Eglin C were tested in vitro to determine its stimulation for the intestinal lymphocyte proliferation and IFN-γ together with IL-6 release in the supernatant. The results showed that higher Eglin C concentrations reduced the stimulation index of lymphocyte proliferation as well as the stimulation index of IFN-γ and IL-6 production. In conclusion, Eglin C protein can be used as a target for therapeutic treatment or as an anti-inflammatory agent for coccidiosis infection.

Spatio-Temporal Changes of Extracellular Matrix (ECM) Stiffness in the Development of the Leech Hirudo verbana.

The invertebrate leech Hirudo verbana represents a powerful experimental animal model for improving the knowledge about the functional interaction between the extracellular matrix (ECM) and cells within the tissue microenvironment (TME), and the key role played by ECM stiffness during development and growth. Indeed, the medicinal leech is characterized by a simple anatomical organization reproducing many aspects of the basic biological processes of vertebrates and in which a rapid spatiotemporal development is well established and easily assessed. Our results show that ECM structural organization, as well as the amount of fibrillar and non-fibrillar collagen are deeply different from hatching leeches to adult ones. In addition, the changes in ECM remodelling occurring during the different leech developmental stages, leads to a gradient of stiffness regulating both the path of migratory cells and their fates. The ability of cells to perceive and respond to changes in ECM composition and mechanics strictly depend on nuclear or cytoplasmic expression of Yes-Associated Protein 1 (YAP1), a key mediator converting mechanical signals into transcriptional outputs, expression, and activation.

Therapeutic effects of Hirudo medicinalis extract antigens on modulation of CD4+CD25+Foxp3 T cell activity in murine eimeriosis.

Eimeriosis is a common parasitic disease in the chicken industry. The aim of this study was to assess the protective role of Hirudo extract antigens (HEA) against murine eimeriosis induced by Eimeria papillate. The oocyst output, developmental stages, goblet cells and oxidative stress, were investigated. Immunohistochemistry was used to detect anti-apoptotic Bcl2 marker and the number of both CD4+ and CD25+ cells in jejunal tissue, while ELISA was used to quantify TGF-ß, IL-10 and IL-22 in jejunal tissue homogenate. Real-time PCR was also used to detect mRNA expression of mucin 2 (MUC2), inducible nitric oxide synthase (iNOS), IL-1ß, IFN-γ, TNF-α, IL-6, and FoxP3. The most effective dose (5 µg/mice) reduced the oocyst output by 82.95 ± 1.02% (P ˂ 0.001). Similarly, the same dose reduced the jejunal developmental stages by 66.67 ± 0.49% (P ˂ 0.001). Furthermore, HEA therapy increased the number of jejunal goblet cells by 12.8 ± 1 (P ˂ 0.001) and the expression of MUC2 by 0.83 ± 0.06 (P ˂ 0.001). In contrast, TNF-α, IFN-γ, IL-6, iNOS, and IL-1ß expression as well as apoptosis were reduced. The number of CD4+ and CD25+ in the jejunal tissue was increased (14.6 ± 1.2 (P ˂ 0.001), 6.84 ± 1 (P ˂ 0.01), respectively) after HEA therapy. The molecular analysis showed an increased expression of intestinal Foxp3 (3.2 ± 0.13 (P ˂ 0.001), while IL-22 was reduced (124 ± 10 (P ˂ 0.001)) versus an increase in TGF-ß (250 ± 17 (P ˂ 0.01)) and IL-10 (236 ± 16 (P ˂ 0.001)) after HEA treatment in comparison to the non-treated infected group. With respect to the infected group, HEA reduced lipid peroxidation (LPO) (15.7 ± 1.12 (P ˂ 0.001)) and nitric oxide (NO) (13 ± 1.3 (P ˂ 0.001)) but increased reduced glutathione (GSH) (3.7 ± 0.26 (P ˂ 0.001)). In conclusion, HEA therapy protected against intestinal tissue damage by activation of CD4+CD25+Foxp3 cells which showed anti-inflammatory action. Hence, HEA can be recommended as a therapeutic treatment for eimeriosis.

Make it double: identification and characterization of a Tandem-Hirudin from the Asian medicinal leech Hirudinaria manillensis.

Haematophagous leeches express a broad variety of secretory proteins in their salivary glands, among them are hirudins and hirudin-like factors. Here, we describe the identification, molecular and initial functional characterization of Tandem-Hirudin (TH), a novel salivary gland derived factor identified in the Asian medicinal leech, Hirudinaria manillensis. In contrast to the typical structure of hirudins, TH comprises two globular domains arranged in a tandem-like orientation and lacks the elongated C-terminal tail. Similar structures of thrombin inhibitors have so far been identified only in kissing bugs and ticks. Expression of TH was performed in both cell-based and cell-free bacterial systems. A subsequent functional characterization revealed no evidence for a thrombin-inhibitory potency of TH.

Serotonin mediates stress-like effects on responses to non-nociceptive stimuli in the medicinal leech Hirudo verbana.

Noxious stimuli can elicit stress in animals that produce a variety of adaptations including changes in responses to nociceptive and non-nociceptive sensory input. One example is stress-induced analgesia that may be mediated, in part, by the endocannabinoid system. However, endocannabinoids can also have pro-nociceptive effects. In this study, the effects of electroshock, one experimental approach for producing acute stress, were examined on responses to non-nociceptive mechanical stimuli and nociceptive thermal stimuli in the medicinal leech (Hirudo verbana). The electroshock stimuli did not alter the leeches' responses to nociceptive stimuli, but did cause sensitization to non-nociceptive stimuli, characterized by a reduction in response threshold. These experiments were repeated with drugs that either blocked synthesis of the endocannabinoid transmitter 2-arachidonoylglycerol (2-AG) or transient receptor potential vanilloid (TRPV) channel, which is known to act as an endocannabinoid receptor. Surprisingly, neither treatment had any effect on responses following electroshock. However, the electroshock stimuli reliably increased serotonin (5-hydroxytryptamine or 5HT) levels in the H. verbana CNS. Injection of 5HT mimicked the effects of the electroshocks, sensitizing responses to non-nociceptive stimuli and having no effect on responses to nociceptive stimuli. Injections of the 5HT receptor antagonist methysergide reduced the sensitization effect to non-nociceptive stimuli after electroshock treatment. These results indicate that electroshocks enhance response to non-nociceptive stimuli but do not alter responses to nociceptive stimuli. Furthermore, while 5HT appears to play a critical role in this shock-induced sensitizing effect, the endocannabinoid system seems to have no effect.

The effects of substrate porosity, mechanical substrate properties and loading conditions on the attachment performance of the Mediterranean medicinal leech (Hirudo verbana).

The ectoparasitic lifestyle of the Mediterranean medicinal leech (Hirudo verbana) requires reliable functioning of its attachment organs (i.e. anterior and posterior suction discs) on multiple habitat- and host-specific surfaces under both normal and shear stresses. In addition to some intrinsic properties of the attachment devices, however, only a few extrinsic factors (e.g. substrate roughness and porosity) have been considered in previous studies on leech suckers. Using centrifugal force experiments, we analysed the attachment performance of H. verbana under different types of loading on artificial substrates differing in porosity and their mechanical properties. Whereas the substrate porosity significantly influenced leech attachment under normal and shear loading, the different mechanical properties did not noticeably affect attachment within the considered parameter limits. Furthermore, suction was confirmed to be the primary attachment mechanism independent of the prevailing loading condition. The question of whether the suction cups of H. verbana are adapted to a specific loading condition could not be answered. In any case, our results again highlight the high functional resilience of leech suckers guaranteeing a successful ectoparasitic lifestyle.

Molecular dynamic and pharmacological studies on protein-engineered hirudin variants of Hirudinaria manillensis and Hirudo medicinalis.

BACKGROUND AND PURPOSE: Hirudin variants are the most powerful thrombin inhibitors discovered to date, with a lower risk of bleeding than heparin. For anticoagulation, the C-termini of hirudin variants bind to the exocite I of thrombin. Anticoagulant effects of gene-recombinant hirudin are weaker than natural hirudin for the reason of lacking tyrosine O-sulfation at C-terminus. EXPERIMENTAL APPROACH: An integrative pharmacological study was carried out using molecular dynamic, molecular biological and in vivo and in vitro experiments to elucidate the anticoagulant effects of protein-engineered hirudins. KEY RESULTS: Molecular dynamic analysis showed that modifications of the C-termini of hirudin variant 1 of Hirudo medicinalis (HV1) and hirudin variant 2 of Hirudinaria manillensis (HM2) changed the binding energy of the C-termini to human thrombin. The study indicated that Asp61 of HM2 that corresponds to sulfated Tyr63 of HV1 is critical for inhibiting thrombin activities. Further, the anticoagulant effects of HV1 and HM2 were improved when the amino acid residues adjacent to Asp61 were mutated to Asp. These improvements were prolongation of the activated partial thromboplastin time, prothrombin time and thrombin time of human blood, and decreased Ki and IC50 values. In the in vivo experiments, mutations at C-termini of HV1 and HM2 significantly changed partial thromboplastin time, prothrombin and thrombin time CONCLUSION AND IMPLICATIONS: The study indicated that the anticoagulant effects of gene-engineered HM2 are stronger than gene-engineered HV1 and HM2-E60D-I62D has the strongest effects and could be an antithrombotic with better therapeutic effects.

The genome of medicinal leech (Whitmania pigra) and comparative genomic study for exploration of bioactive ingredients.

BACKGROUND: Leeches are classic annelids that have a huge diversity and are closely related to people, especially medicinal leeches. Medicinal leeches have been widely utilized in medicine based on the pharmacological activities of their bioactive ingredients. Comparative genomic study of these leeches enables us to understand the difference among medicinal leeches and other leeches and facilitates the discovery of bioactive ingredients. RESULTS: In this study, we reported the genome of Whitmania pigra and compared it with Hirudo medicinalis and Helobdella robusta. The assembled genome size of W. pigra is 177 Mbp, close to the estimated genome size. Approximately about 23% of the genome was repetitive. A total of 26,743 protein-coding genes were subsequently predicted. W. pigra have 12346 (46%) and 10295 (38%) orthologous genes with H. medicinalis and H. robusta, respectively. About 20 and 24% genes in W. pigra showed syntenic arrangement with H. medicinalis and H. robusta, respectively, revealed by gene synteny analysis. Furthermore, W. pigra, H. medicinalis and H. robusta expanded different gene families enriched in different biological processes. By inspecting genome distribution and gene structure of hirudin, we identified a new hirudin gene g17108 (hirudin_2) with different cysteine patterns. Finally, we systematically explored and compared the active substances in the genomes of three leech species. The results showed that W. pigra and H. medicinalis exceed H. robusta in both kinds and gene number of active molecules. CONCLUSIONS: This study reported the genome of W. pigra and compared it with other two leeches, which provides an important genome resource and new insight into the exploration and development of bioactive molecules of medicinal leeches.

Comparison of body wall histologic structure of two medicinal leeches Hirudo sulukii and Hirudo verbana (Hirudinida: Hirudinidae).

In this study, it was aimed to determine secretory cell types using histochemical properties of secretory cells and epidermis histology in the body wall of two medicinal leech species, Hirudo verbana and Hirudo sulukii. In addition, areas of epidermis epithelial cells, secretory cell types, and secretion areas of secretory cells stained with histochemical stains were statistically compared in both species. Epidermis is composed of single layer of cylindrical epithelium and secretory cells. The cuticle layer covers the epithelial layer. Some Type 1 cells within and close to the epidermis were determined as pear-shaped secretory cells. Type 2a and Type 2b secretory cells were found in large groups in the inner parts of the body wall, especially around muscles. While Type 1 cells were stained weakly with PAS and AB, Type 2b cells were stained darker than Type 2a cells. Statistical calculations showed that areas of epithelial and secretory cells were generally larger in H. sulukii than in H. verbana. Therefore, H. sulukii was thought to be a more resistant species compared to H. verbana. As secretion areas of secretory cells reacting with PAS and AB stains were generally larger in H. sulukii, it was concluded that mucus composition between the two species has different concentration.

Hirudotherapy in Wound Healing.

Leeches are hermaphrodite, bloodsucking parasitic worms usually found in places with fresh water. Leech therapy existed 3000 years, and it is being used at a different scope. Several species of leeches have been used in medicine, and the most common species used is Hirudo medicinalis. Leeches suck the excess blood, reduce the swelling in the tissues, and promote healing by allowing fresh oxygenated blood to reach the area until normal circulation can be restored. Pain relief from leech therapy is rapid, effective, and long-lasting in many conditions. The aim of this study was to evaluate the efficacy and duration of healing utilizing sterile medicinal leeches, Hirudinaria manillensis, in the management of pain and wound healing. Leech was taken out from its sterile tube by using a pair of non-tooth sterile plastic forceps and gloved hands. Each leech was left in place for as long as it was feeding. Leeches were removed only after they became detached from the patient. The specimen jars containing the used leeches were sealed in either a biohazard bag or in a small yellow clinical waste bin liner securely fastened with a cable tie. The leech was killed by using 70% alcohol prior to disposal into a yellow hazard bin, which undergoes incineration. All 3 patients had improvements in their condition, especially in terms of reduction in the pain and improvement in their sense of balance. All the wounds healed well. Therefore, leech therapy is effective in reducing pain and increasing perfusion to allow the wounds to heal quickly. However, a more robust trial is needed to show significance as the sample size is small.

Recombinant Destabilase from Hirudo medicinalis Is Able to Dissolve Human Blood Clots In Vitro.

Leeches are amazing animals that can be classified as conditionally poisonous animals since the salivary cocktail they produce is injected directly into the victim, and its components have strictly defined biological purposes, such as preventing blood clot formation. Thrombolytic drugs are mainly aimed at treating newly formed blood clots. Aged clots are stabilized by a large number of isopeptide bonds that prevent the action of thrombolytics. These bonds are destroyed by destabilase, an enzyme of the leech's salivary glands. Here, we conducted a pilot study to evaluate the feasibility and effectiveness of the use of destabilase in relation to blood clots formed during real pathological processes. We evaluated the isopeptidase activity of destabilase during the formation of a stabilized fibrin clot. We showed that destabilase does not affect the internal and external coagulation cascades. We calculated the dose-response curve and tested the ability of destabilase to destroy isopeptide bonds in natural blood clots. The effect of aged and fresh clots dissolving ability after treatment with destabilase coincided with the morphological characteristics of clots during surgery. Thus, recombinant destabilase can be considered as a potential drug for the treatment of aged clots, which are difficult to treat with known thrombolytics.

Short tail stories: the hirudin-like factors HLF6 and HLF7 of the Asian medicinal leech, Hirudinaria manillensis.

The leech-derived hirudins and hirudin-like factors (HLFs) share a common molecule structure: a short N-terminus, a central globular domain, and an elongated C-terminal tail. All parts are important for function. HLF6 and HLF7 were identified in the Asian medicinal leech, Hirudinaria manillensis. The genes of both factors encode putative splice variants that differ in length and composition of their respective C-terminal tails. In either case, the tails are considerably shorter compared to hirudins. Here we describe the functional analyses of the natural splice variants and of synthetic variants that comprise an altered N-terminus and/or a modified central globular domain. All natural splice variants of HLF6 and HLF7 display no detectable thrombin-inhibitory potency. In contrast, some synthetic variants effectively inhibit thrombin, even with tails as short as six amino acid residues in length. Our data indicate that size and composition of the C-terminal tail of hirudins and HLFs can vary in a great extent, yet the full protein may still retain the ability to inhibit thrombin.

Spectral responses across a dorsal-ventral array of dermal sensilla in the medicinal leech.

How do animals use visual systems to extract specific features of a visual scene and respond appropriately? The medicinal leech, Hirudo verbana, is a predatory, quasi-amphibious annelid with a rich sensorium that is an excellent system in which to study how sensory cues are encoded, and how key features of visual images are mapped into the CNS. The leech visual system is broadly distributed over its entire body, consisting of five pairs of cephalic eyecups and seven segmentally iterated pairs of dermal sensilla in each mid-body segment. Leeches have been shown to respond behaviorally to both green and near ultraviolet light (UV, 365-375 nm). Here, we used electrophysiological techniques to show that spectral responses by dermal sensilla are mapped across the dorsal-ventral axis, such that the ventral sensilla respond strongly to UV light, while dorsal sensilla respond strongly to visible light, broadly tuned around green. These results establish how key features of visual information are initially encoded by spatial mapping of photo-response profiles of primary photoreceptors and provide insight into how these streams of information are presented to the CNS to inform behavioral responses.